Toll-free:400-690-0195ENGLISH简体中文
Search:

miRNA Inhibitor

Home-Products & services--miRNA Inhibitor

Product Description

GenePharma miRNA inhibitors are chemically-modified and optimized nucleic acids designed to specifically target the microRNA (miRNA) molecules in cells. Endogenous microRNAs are small

  • Description
  • Experimental
  • Usage
  • Application
  • Ordering

GenePharma miRNA inhibitors are chemically-modified and optimized nucleic acids designed to specifically target the microRNA (miRNA) molecules in cells. Endogenous microRNAs are small, regulatory RNAs that are expressed in animals and plants that affect the translation of target mRNAs. The mature 17-24 nucleotide, single-stranded miRNAs specifically target a protein complex to regulate translation at the level of mRNA. The miRNA inhibitors are sequence-specific and chemically-modified to specifically target and knockdown individual miRNA molecules. With the Anti-miR miRNA inhibitors, you can:


             Control specific miRNA activity

             Tightly regulate miRNA cellular levels

             Achieve optimal delivery efficiency with minimal cytotoxicity

Use of the miRNA inhibitors will enable miRNA functional analysis for down-regulation of miRNA activity. Specific experimental designs include:

               
             miRNA target site identification and validation

            Screening for miRNAs that regulate the expression of a gene

            Screening for miRNAs that affect a cellular process

Cellular functions identified by miRNA inhibitors can be further investigated with the GenePharma miRNA Molecules, which enable loss-of-function experiments through reduction of miRNA activity.

Cat. No.

Product Description

Quantity

Purification

Price

Times

B03001

GMR-miR microRNA inhibitors

2 OD

HPLC

$89

1 week

B04004

GMR-miR microRNA inhibitors FAM-labeled single-stranded negative control

1OD

HPLC

$38

1 week

Store at or below –20°C.
Do not store in a frost-free freezer.

 

 

 

Product Description:

 

 

A single-stranded RNA oligonucleotide designed for use in miRNA function research.

 

Appearance:

Powder

 

 

 

Product Inhibitors

Sanger miRNA Registry ID#:
For example: hsa-miR-1
Mature miRNA Sequence: UGGAAUGUAAAGAAGUAUGUA
Inhibitor Sequence: UACAUACUUCUUUACAUUCCA

 

 

 

Storage Conditions:

 

 

Store at or below –20°C. Do not store in a frost-free freezer. (Dried oligonucleotides are shipped at ambient temperature.)

 

 

 

USER INFORMATION

 

 

 

General Information:

 

 

GenePharma miRNA Inhibitors are designed to inhibit the activity of endogenous miRNAs when introduced into cells. These RNA-based inhibitors are chemically modified to increase their stability.
GenePharma miRNA Inhibitors can be delivered to mammalian cells by chemical transfection or electroporation.

Handling Instructions:

 

 

RNA oligonucleotides are susceptible to degradation by exogenous ribonucleases introduced during handling. Wear gloves when handling this product. Use RNase-free reagents, tubes, and barrier pipette tips. Upon receipt, store in a non-frost-free freezer at or below –20°C (dried oligonucleotides are shipped at ambient temperature).
Resuspension Instructions
Briefly centrifuge the tube to ensure that the dried oligonucleotide is at the bottom of the tube. Resuspend the oligonucleotide at a convenient concentration. To minimize freeze-thaw cycles, we recommend preparing a concentrated stock, such as 20 μM, and then further diluting to a practical working stock concentration. (Resuspend 5 nmol of oligonucleotide in 250 μL of Nuclease-free Water to obtain a 20 μM solution.)

 

 

 

Applications:

 

 

miRNA Inhibitor is designed for use in miRNA experiments and cell cultures to intervene miRNA-mediated gene silencing. For this application, a miRNA Inhibitor is introduced into cells that express the corresponding miRNA, and the expression of the endogenous target of the corresponding miRNA, or of a reporter construct containing the predicted target miRNA binding site, is measured.

Expression of Endogenous miRNA Targets
To analyze the effects that miRNAs have on an endogenous target, the miRNA Inhibitor can be transfected into cells to evaluate whether the endogenous mRNA target expression is reversed in protein level.
Expression of miRNA Target Reporter Plasmid
Reporter plasmids, with a or several miRNA binding sites in the 3’ UTR of the reporter gene, are commonly used to to evaluate the direct interaction between miRNA-potential miRNA targets. When cotransfected with a reporter plasmid containing corresponding miRNA binding site, a miRNA Inhibitor can relieve the inhibition of gene expression caused by an endogenous miRNA. This type of experiment typically also includes a second reporter plasmid to normalize for transfection variation.

We recommend transfection with nontargeting miRNA inhibitor negative control as a baseline reference. Nontargeting miRNA inhibitor negative control should be used at the same concentration as experimental target miRNA inhibitor, because nucleic acid concentrations within cells can affect the activity and specificity of miRNAs.

Transfection Starting Points for Mammalian Cells
As with other small nucleic acids, such as siRNAs and antisense oligonucleotides, the efficiency with which mammalian cells are transfected with miRNA inhibitors will vary according to cell type and the transfection reagent used. The optimal concentration used for transfections should be determined empirically.

General Transfection Starting Points for microRNA inhibitors in Cultured Mammalian Cells

 

 

 

Plate Format

96 wells

24 wells

12 wells

6 wells

Transfection Reagenta

0.3–1.0 μL

1–3 μL

2–4 μL

3–6 μL

miRNA Inhibitorsb

3 pmol

15 pmol

30 pmol

75 pmol

Cell Density c

6,000 cells/well

40,000 cells/well

80,000 cells/well

200,000 cells/well

Final Volume per Well

0.1 mL

0.5 mL

1.0 mL

2.5 mL

 

 

 

a Refer to the instructions provided with your transfection reagent for the recommended volume.

b The amount shown results in a final miRNA inhibitors concentration of 30 nM. The amount of miRNA inhibitors required for maximal miRNA inhibitors activity will vary among cell types. For a 96-well plate and 100 μL final transfection volume, 3 pmol of a 5 μM oligonucleotide solution is 0.6 μL. Robotic pipettors may require volumes of 2–5 μL for accurate pipetting. To increase pipetting volumes and accuracy when preparing transfection complexes, we recommend first making a plate with a dilution of your stock oligonucleotide

c Optimal cell density will vary among cell types, depending on cell size and growth characteristics. In general, we recommend 30–70% confluency.

 

 

 

Transfection Optimization
Optimizing transfection efficiency is crucial for maximizing miRNA inhibitors activity while minimizing cytotoxicity. Optimal transfection efficiencies are achieved by identifying an effective transfection reagent for each cell type and by adjusting (in order of importance):
● Amount of transfection reagent
● Amount and type of RNA oligonucleotide
● Cell density at the time of transfection
● Order of transfection (pre-plating cells or plating cells/transfecting in tandem)
● Length of exposure of cells to transfection reagent/microRNA inhibitors complexes

Most protocols recommend maintaining mammalian cells in the medium used for transfection; this avoids dilution or removal of RNA oligonucleotides from the cells by adding medium or washing the cells with new medium too soon after transfection. We have found that cells typically exhibit greater viability when existing medium is replaced with fresh medium 24 hours after transfection. Replacing medium after 24 hours generally does not change the activity of the transfected miRNA inhibitors. Once the conditions for optimal transfection efficiency are determined, they should be kept constant from experiment to experiment for a given cell type.

 

 

 

References:

 

 

1. Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. (2005) Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433(7027):769–773.

2. Lee RC, Feinbaum RL, Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75(5):843–854.

3. Wightman B, Ha I, Ruvkun G (1993) Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75(5):855–862.

4. Yekta S, Shih IH, Bartel DP. 2004. MicroRNA-directed cleavage of HOXB8 mRNA. Science
304(5670):594–596.

5. Bagga S, Bracht J, Hunter S, Massirer K, Holtz J, Eachus R, Pasquinelli AE (2005) Regulation by let-7 and lin-4 miRNAs results in target mRNA degradation. Cell 122(4):553–563.

6. Jing Q, Huang S, Guth S, Zarubin T, Motoyama A, Chen J, Di Padova F, Lin SC, Gram H, Han J (2005) Involvement of microRNA in AU-rich element-mediated mRNA instability. Cell 120(5):623–634.

7. Schramke V, Sheedy DM, Denli AM, Bonila C, Ekwall K, Hannon GJ, Allshire RC. 2005.
RNA-interference-directed chromatin modification coupled to RNA polymerase II transcription. Nature
435(7046):1275–1279.

8. Bustin SA (2002) Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol. 29(1):23–39.

QUALITY CONTROL

Purity:

Analytical HPLC of a sample of purified single-stranded RNA oligonucleotide is used to confirm ≥97% purity.

  1. Paik JH, Jang JY, Jeon YK, Kim WY, Kim TM, Heo DS, Kim CW. MicroRNA-146a downregulates NF{kappa}B activity via targeting TRAF6, and functions as a tumor suppressor having strong prognostic implications in NK/T cell lymphoma. Clin Cancer Res. 2011 May 26.

  2. Hussain M, Frentiu FD, Moreira LA, O’Neill SL, Asgari S. Wolbachia uses host microRNAs to manipulate host gene expression and facilitate colonization of the dengue vector Aedes aegypti. Proc Natl Acad Sci U S A. 2011 May 31;108(22):9250-5.

  3. Zheng YS, Zhang H, Zhang XJ, Feng DD, Luo XQ, Zeng CW, Lin KY, Zhou H, Qu LH, Zhang P, Chen YQ. MiR-100 regulates cell differentiation and survival by targeting RBSP3, a phosphatase-like tumor suppressor in acute myeloid leukemia. Oncogene. 2011 Jun 6.

  4. Wang J, Gu Z, Ni P, Qiao Y, Chen C, Liu X, Lin J, Chen N, Fan Q. NF-kappaB P50/P65 hetero-dimer mediates differential regulation of CD166/ALCAM expression via interaction with micoRNA-9 after serum deprivation, providing evidence for a novel negative auto-regulatory loop. Nucleic Acids Res. 2011 May 13.

  5. Hu R, Liu W, Li H, Yang L, Chen C, Xia ZY, Guo LJ, Xie H, Zhou HD, Wu XP, Luo XH. A Runx2/miR-3960/miR-2861 regulatory feedback loop during mouse osteoblast differentiation. J Biol Chem. 2011 Apr 8;286(14):12328-39.

  6. Xu Z, Xiao SB, Xu P, Xie Q, Cao L, Wang D, Luo R, Zhong Y, Chen HC, Fang LR. miR-365, a Novel Negative Regulator of Interleukin-6 Gene Expression, Is Cooperatively Regulated by Sp1 and NF-{kappa}B. J Biol Chem. 2011 Jun 17;286(24):21401-12.

  7. Gong C, Yao Y, Wang Y, Liu B, Wu W, Chen J, Su F, Yao H, Song E. Up-regulation of miR-21 Mediates Resistance to Trastuzumab Therapy for Breast Cancer. J Biol Chem. 2011 May 27;286(21):19127-37.

  8. Ye G, Fu G, Cui S, Zhao S, Bernaudo S, Bai Y, Ding Y, Zhang Y, Yang BB, Peng C. MicroRNA 376c enhances ovarian cancer cell survival by targeting activin receptor-like kinase 7: implications for chemoresistance. J Cell Sci. 2011 Feb 1;124(Pt 3):359-68.

  9. Zheng J, Xue H, Wang T, Jiang Y, Liu B, Li J, Liu Y, Wang W, Zhang B, Sun M. miR-21 downregulates the tumor suppressor P12 CDK2AP1 and stimulates cell proliferation and invasion. J Cell Biochem. 2011 Mar;112(3):872-80. doi: 10.1002/jcb.22995.

  10. Yuan B, Dong R, Shi D, Zhou Y, Zhao Y, Miao M, Jiao B. Down-regulation of miR-23b may contribute to activation of the TGF-β1/Smad3 signalling pathway during the termination stage of liver regeneration. FEBS Lett. 2011 Mar 23;585(6):927-34.

  11. Huang J, Wang Y, Guo Y, Sun S. Down-regulated microRNA-152 induces aberrant DNA methylation in hepatitis B virus-related hepatocellular carcinoma by targeting DNA methyltransferase 1. Hepatology. 2010 Jul;52(1):60-70.

  12. Wang P, Hou J, Lin L, Wang C, Liu X, Li D, Ma F, Wang Z, Cao X. Inducible microRNA-155 feedback promotes type I IFN signaling in antiviral innate immunity by targeting suppressor of cytokine signaling 1. J Immunol. 2010 Nov 15;185(10):6226-33.

  13. Liu X, Zhan Z, Xu L, Ma F, Li D, Guo Z, Li N, Cao X. MicroRNA-148/152 impair innate response and antigen presentation of TLR-triggered dendritic cells by targeting CaMKIIα. J Immunol. 2010 Dec 15;185(12):7244-51.

  14. Smrt RD, Szulwach KE, Pfeiffer RL, Li X, Guo W, Pathania M, Teng ZQ, Luo Y, Peng J, Bordey A, Jin P, Zhao X. MicroRNA miR-137 regulates neuronal maturation by targeting ubiquitin ligase mind bomb-1. Stem Cells. 2010 Jun;28(6):1060-70.

  15. Yan H, Wu J, Liu W, Zuo Y, Chen S, Zhang S, Zeng M, Huang W. MicroRNA-20a overexpression inhibited proliferation and metastasis of pancreatic carcinoma cells. Hum Gene Ther. 2010 Dec;21(12):1723-34.

  16. Neal CS, Michael MZ, Rawlings LH, Van der Hoek MB, Gleadle JM. The VHL-dependent regulation of microRNAs in renal cancer. BMC Med. 2010 Oct 21;8:64.

  17. Wu ZS, Wu Q, Wang CQ, Wang XN, Wang Y, Zhao JJ, Mao SS, Zhang GH, Zhang N, Xu XC. MiR-339-5p inhibits breast cancer cell migration and invasion in vitro and may be a potential biomarker for breast cancer prognosis. BMC Cancer. 2010 Oct 9;10:542.

  18. Li H, Bian C, Liao L, Li J, Zhao RC. miR-17-5p promotes human breast cancer cell migration and invasion through suppression of HBP1. Breast Cancer Res Treat. 2011 Apr;126(3):565-75. Epub 2010 May 27.

  19. Cao G, Huang B, Liu Z, Zhang J, Xu H, Xia W, Li J, Li S, Chen L, Ding H, Zhao Q, Fan M, Shen B, Shao N. Intronic miR-301 feedback regulates its host gene, ska2, in A549 cells by targeting MEOX2 to affect ERK/CREB pathways. Biochem Biophys Res Commun. 2010 Jun 11;396(4):978-82.

  20. Hao J, Zhang S, Zhou Y, Hu X, Shao C. MicroRNA 483-3p suppresses the expression of DPC4/Smad4 in pancreatic cancer. FEBS Lett. 2011 Jan 3;585(1):207-13. Epub 2010 Nov 27.

Ordering

The first problem we meet for the application of siRNA is to design the sequences. Although there are quite a lot principles for the designing of published sequences and quite a few companies supply on-line design service, up to now, no software can guarantee the efficiency of the oligos designed.
Shanghai GenePharma Co, Ltd. and our collaboration laboratories have been involved in RNAi research for some time. For each specific gene target, if 4 pairs of oligos were designed and synthesized, normally you will have at least one pair showing 70% down regulation.
Our price: 2OD, PAGE purified, $89/pair
*If one single order is less than 5 pairs extra shipping fee of $40 will be charged. Payment terms are 30 days. We accept cheque or wire transfer into our USD account.
Specifications of siRNA Oligos:
Quality Control:
All our siRNA oligos undergo vigorous process monitoring and strict quality control. Length and labeling are systematically controlled by PAGE or mass spectrometry analysis. Quantity is systematically validated by UV absorbance at 260 nm.
Purification: Fully deprotected and desalted.
Purified by PAGE or RP-HPLC upon request
Length: 19 to 23 mers
Bases: RNA (A, C, G or U)
DNA (A, C, G or T)
Backbone: Phosphodiester bond
Labels and modifications: Fluorescein, biotin and phosphate: 3’ or 5’end
Other labels available upon request
Format: Single-strand RNA oligos is delivered in dry form
Storage and stability
Although oligonucleotides are stable in solution at 4°C for up to 2 weeks, we recommend storage should be at -20°C. Repetitive freeze-thaw cycles should be avoided by storing as aliquots. For long-term storage, siRNA oligos should be dried.
Oligonucleotides with fluorescent labels should be protected from light. We guarantee our oligonucleotides for six months, when stored under the above conditions.
Shipment: Shipped by express delivery, dry in individual, transparent tubes.
Oligonucleotide Technical Data Sheet
Oligonucleotides are delivered with an Oligonucleotide Technical Data Sheet, which includes oligonucleotide name, sequence, concentration, size,  purification method.

Services available upon request

  1. Aliquoting
  2. Free design support
  3. Additional services may increase turn-around time

Ordering:Please fill in the following order form and send it to: order@genepharma.com or by fax to:00862151320295 our staff will confirm with you asap.